Faculty of Science

DEVELOPMENT AND VALIDATION OF qPCR TARGETS FOR PORPHYROMONAS
GINGIVALIS ABUNDANCE AND THE EXPRESSION LEVELS OF GENES IN THE
HUMAN ORAL MICROBIOME
2023 | JULIANA KAITLYN HERMISTON

B.Sc. HONOURS THESIS - BIOLOGY

DEVELOPMENT AND VALIDATION OF qPCR TARGETS FOR Porphyromonas
gingivalis ABUNDANCE AND THE EXPRESSION LEVELS OF GENES IN THE
HUMAN ORAL MICROBIOME
by
JULIANA KAITLYN HERMISTON

A THESIS SUBMITTED IN PARTIAL FULFILLMENT
OF THE REQUIREMENT FOR THE DEGREE OF

BACHELOR OF SCIENCE (HONS.)
in the
DEPARTMENT OF BIOLOGICAL SCIENCES
(Cellular, Molecular, Microbial Biology)

This thesis has been accepted as conforming to the required standards by:
Eric M. Bottos (Ph.D.), Thesis Supervisor, Dept. Biological Sciences
Mark E. Rakobowchuk (Ph.D.), Co-supervisor, Dept. Biological Sciences
Jonathan D. Van Hamme (Ph.D.), Co-Supervisor, Dept. Biological Sciences
Matthew Reudink (Ph.D.), External Committee Member, Dept. Biological Sciences
Dated this 5th day of May, 2023, in Kamloops, British Columbia, Canada
© Juliana Kaitlyn Hermiston, 2023

ABSTRACT
Porphyromonas gingivalis is a pathogen found in patients with periodontitis that produces
toxic cysteine proteases called gingipains. Gingipains are characterized as narrow-spectrum
virulence targets. Broad-spectrum antibiotics do not eliminate P. gingivalis but, instead, add to its
resistance. Sometimes found in the brains of Alzheimer’s patients, it has been suggested that P.
gingivalis, and the gingipains it produces, is involved in cognitive decline. Specifically, lysinegingipan and arginine gingipain A and B are crucial to the pathogenicity of P. gingivalis and are
involved in host colonization, suppression of host defenses, nutrient acquisition, and tissue
destruction. It has been found that inhibiting gingipain production decreases P. gingivalis brain
colonization, reducing neurodegeneration in Alzheimer’s disease. Similarly, it has been suggested
that dietary nitrate supplementation may limit P. gingivalis proliferation. The work presented here
builds on a clinical trial where participants were given nitrate pills and monitored for changes in
oral microbiome community composition. Twenty human oral microbiome RNA samples were
subjected to reverse transcriptase quantitative PCR (RT-qPCR) analysis to quantify the abundance
of P. gingivalis and the expression levels of genes involved in gingipain production, iron
acquisition from host heme, as well as nitrate metabolism. This study designed and validated
primers and probes for qPCR for hmuY, kgp, and narG. We found that hmuY, kgp, and narG were
amplified of correct size in the positive control samples (100 ng/µL stock P. gingivalis,
AlphaDNA), suggesting that the primer targets are accurate. This work will lay foundation for
quantifying the absolute abundance of P. gingivalis and the expression levels of hmuY, kgp, and
narG in the cDNA samples using qPCR, and, overall, how nitrate supplementation affects these
abundances. Additionally, results from the qPCR analysis will give us more precise measurements
of how much Porphyromonas sp. are present in the samples which can then be compared to the

ii

physiological responses to nitrate supplementation from the study conducted by Freeze et al.
(2022). It is hypothesized that reduction in the expression of gingipains and iron acquisition genes,
and an increase in the expression of nitrate reductase genes, post nitrate supplementation, will
correlate with reduced P. gingivalis abundance.

Thesis Supervisors: Drs. Eric M. Bottos, Mark E. Rakobowchuk, and Jonathan D. Van Hamme

iii

ACKNOWLEDGEMENTS
I would first like to thank the participants who volunteered to take part in this study, many of
them being students, friends, and professors at TRU.

Thank you to my friends and family for always supporting my goals and supporting me throughout
each stage of the research process. A very special thank you to my friend Natalie Pietramala for
holding my hand throughout undergrad and for your never-ending encouragement.

Thank you to Ashley Fischer and Breanne McAmmond for being incredible mentors during my
time in the TRUGen lab; the mentorship laid the foundation for my research journey. Your
encouragement and support are forever appreciated, and I am certain that the experience would
not have been the same without you both.

I would like to extend my utmost gratitude towards Gwen Freeze. Thank you for being such a
positive light in my life. It was a privilege to walk alongside you for this project, and your
continued support and encouragement is more appreciated than words can describe. You are an
inspiration for many! Even miles apart, I’ve never felt more loved and supported.

Thank you to Dr. Mark Rakobowchuk for your constant support and encouragement throughout
the entirety of the project. The care and attention you have put into this project as well as your
undying support of my research journey will be forever appreciated.

Thank you to Dr. Jon Van Hamme for your endless support of my research endevours. The
opportunities that I have had during my time in the TRUGen lab are ubiquitous, and I have gained
countless skills that I will undoubtedly take into my future career. Your support for not only my
research journey but my academic career as a whole is beyond appreciated.

Finally, thank you to Dr. Eric Bottos for being such a supportive and encouraging mentor
throughout this project. Your dedication to your students does not go unnoticed. The countless
hours you spent with me in the lab and the many skills that you have taught me are greatly
appreciated. Thank you for making this such an invaluable experience.

iv

TABLE OF CONTENTS
ABSTRACT ...................................................................................................................................ii
ACKNOWLEDGMENTS .............................................................................................................iv
1 INTRODUCTION .......................................................................................................................1
1.1 Alzheimer’s Disease .....................................................................................................1
1.1.1 Amyloid-ß plaques .........................................................................................1
1.1.2 Neurofibrillary tangles and tau proteins ........................................................2
1.2 Proliferation of Porphyromonas gingivalis in the oral cavity ………………………..3
1.3 Proliferation of Porphyromonas gingivalis in the brain ……………………..……….4
1.4 Gingipain Inhibition …………………………………………………………………..5
1.4.1 Nitrate Supplementation …………………………………….……………....6
2 MATERIALS AND METHODS .................................................................................................8
2.1 Ethical approval .............................................................................................................8
2.2 Study participants ..........................................................................................................8
2.3 Experimental design ......................................................................................................9
2.4 Oral Bacterial Sampling ...............................................................................................10
2.4.1 Hard tissue floss …………………………………………………………...10
2.5 RNA Isolation ……………………………………………………………………….10
2.6 RNA Quantification ………………………………………………………………....11
2.7 Reverse Transcriptase Polymerase Chain Reaction …………………………………11
2.8 Primer and Probe Design ………………………………………………………...….12
2.8.1 Acquiring Sequences from the National Centre for Biotechnology
Information (NCBI) ………………...…………………………………….12
2.8.2 Geneious Prime Software …………………………………..……………..13
2.9 Amplification Using Polymerase Chain Reaction. ………………………………....13
2.9.1 Amplification of the kgp gene …………………………………………….13
2.9.2 Amplification of the hmuY gene …………………………………………..14
2.9.3 Amplification of the narG Gene …………………………………………..15
2.9.4 Amplification of the 16SrRNA Gene …………………………………...…16

v

3 RESULTS ……………………………………………………………………..…….…………17
3.1 Primer and Probe Combinations from Geneious Prime …………………..…………..17
3.2 Reverse Transcriptase Polymerase Chain Reaction ………………………….………18
3.3 Primer Combination Testing ……………………………………………..………….20
3.3.1 kgp ……………………………………………………………...………….21
3.3.2 hmuY …………………………………………………………………….…21
3.3.3 narG …………………………………………………………….………….22
3.3.4 16SrRNA …………………………………………………….……………..23
3.3.5 Primer and Probe Combinations that Demonstrated Amplification ………23
4 DISCUSSION …………………………………………………………………………………24
4.1 Primer Design ………………………………………………………………...……..25
4.1.1 kgp and hmuY ……………………………………………………………...25
4.1.2 narG ……………………………………………………………….……….26
4.1.3 16SrRNA ………………………………………………………….………..26
4.2 Conclusions and Future Work ………………………………………………..………27
5 LITERATURE CITED ……………………………………………………………….………..29
6 APPENDIX …………………………………………………………………………..………..33

vi

LIST OF FIGURES
Figure 1. Methodology and timeline showing how the RNA extracts were obtained from the
previous study conducted by Freeze et al. (2022) ………..……………………………….11
Figure 2. Primers and probes were designed to target regions of the cDNA for subsequent
quantitative polymerase chain reaction (qPCR) ……………..………..………………….16
Figure 3. Agarose gel confirming the reverse transcription of the RNA samples (P01pre-P05pre)
using reverse transcriptase polymerase chain reaction +ve = positive; -ve = negative; RT
= reverse transcription ……………………………………..…………………………….18
Figure 4. Agarose gel confirming the reverse transcription of the RNA samples (P06pre-P10pre)
using reverse transcriptase polymerase chain reaction +ve = positive; -ve = negative; RT
= reverse transcription …………………………………….……….…………………….18
Figure 5. Agarose gel confirming the reverse transcription of the RNA samples (P01postP05post) using reverse transcriptase polymerase chain reaction. +ve = positive; -ve =
negative; RT = reverse transcription ……………………….…………………………….19
Figure 6. Agarose gel confirming the reverse transcription of the RNA samples (P06postP10post) using reverse transcriptase polymerase chain reaction. +ve = positive; -ve =
negative; RT = reverse transcription …………...……………….………………………..19
Figure 7. Agarose gel confirming the amplification of kgp with the 80F/183R, 362F/437R, and
2436F/2516R primer sets. +ve = positive; -ve = negative ………..………...…………….20
Figure 8. Agarose gel confirming the amplification of hmuY with the 384F/513R primer set. +ve
= positive; -ve = negative ……………………………………….………………………..21
Figure 9. Agarose gel confirming the amplification of narG with the 2383F/2515R primer set.
+ve = positive; -ve = negative ……………………………………....……………………22

vii

LIST OF TABLES
Table 1. Summary of the four gene targets in which primers and probes will be designed for
qPCR ……………………...……………………………………………………………..13
Table 2. Primer and probe combinations selected for testing using polymerase chain reaction
(PCR) ………………………………………………………….…………………………17
Table 3. Primer and probe combinations selected for quantitative polymerase chain reaction
(qPCR) …………………………………………………………….……………………..23
Table 4. RNA concentrations of floss samples analyzed in this study (n=20) ………...………….33

viii

1 INTRODUCTION
1.1 Alzheimer’s disease
Alzheimer’s disease (AD) is a neurogenerative disease characterized by its gradual decline in
cognitive function, specifically in brain areas that are responsible for learning and memory
(Kametani and Hasegawa 2018; Raji 2009; Anand and Dhikav 2012). As the most common form
of dementia, AD has been studied for several decades; however, the pathogenesis of this disease
remains poorly understood (Santos et al. 2017). Risk factors contributing to the development of
AD, such as aging, genetic predisposition, immune dysfunction, and poor cardiovascular health,
have been well established, but currently there are no methods of treatment to prevent or cure the
disease (Armstrong 2013; Santos et al. 2017). Two abnormal structures called amyloid-ß (Aß)
plaques and neurofibrillary tangles (NFTs) found in the brain have distinguished AD from other
neurodegenerative diseases (Glenner and Wong 1984; Grundle-Iqbal et al. 1986). Aß plaques are
made up of Aß peptide chains whereas NFTs are accumulations of hyperphosphorylated tau
proteins (d’Errico and Meyer-Luehmann 2020). Research has shown that the accumulation of these
structures, specifically in the hippocampus and entorhinal cortex regions of the brain, directly
damages neural synapses (d’Errico and Meyer-Luehmann 2020).
1.1.1 Amyloid-ß plaques
Amyloid-ß (Aß), a product of the glycoprotein amyloid precursor transmembrane protein
found in brain tissue, regulates neuron growth, synaptic functions, neuroprotection, as well as
mediates nervous system development (Chen et al. 2017; d’Errico and Meyer-Luehmann 2020).
In a healthy individual, Aß monomers are formed in the brain and released into the extracellular
space where they are either degraded or transported out of the organ (Chen et al. 2017).
Contrastingly, in persons with AD, Aβ aggregates into soluble oligomers that can accumulate in

1

the brain, driving synaptic dysfunction, or into larger insoluble amyloid fibrils that can form
plaques (d’Errico and Meyer-Luehmann 2020; Chen et al. 2017). Research suggests that Aβ plaque
formation plays a role in AD pathogenesis by inducing neuronal loss, synaptic dysfunction, and
disrupting neural connectivity (d’Errico and Meyer-Luehmann 2020; Chen et al. 2017; Murphy
and Levine 2010). The mechanism by which this occurs remains unclear however existing
hypotheses allude to the abnormal tendency of Aß to aggregate into plaques, or the important role
that Aß plays as an antimicrobial peptide (Kumar et al. 2017).
More recently, Aß as an antimicrobial peptide that protects the host from microbial
invasion has been studied (Kumar et al. 2017; Gosztyla et al. 2018). Aß functions by binding and
intercepting microorganisms from entering neurons; this reduces microbial adhesion to host cells
and eventually kills bacteria (Kumar et al. 2017). Despite the protective nature of Aß, studies have
suggested that it can become dysregulated in response to microbial invasion and cause
inflammation, host cell toxicity, and degenerative pathologies such as ones seen in AD (Kumar et
al. 2017). Therefore, the accumulation of Aß plaques in AD patients may be a result of an
overactive innate immune system in the brain in response to microbial invasion (Kumar et al.
2017).
1.1.2 Neurofibrillary tangles and tau protein
Like Aß plaques, neurofibrillary tangles (NFTs) may also play an important role in the
pathogenesis of AD. NFTs are composed of filaments of the microtubule-associated
phosphoprotein, tau – a protein responsible for microtubule assembly and stability (Kametani and
Hasegawa 2018). In AD, the tau protein becomes hyperphosphorylated, causing the microtubules
to disassemble and release the tau protein (d’Errico and Meyer-Luehmann 2020; Medeiros et al.
2011). The tau proteins then aggregate within the cytosol and inhibit normal neuronal signalling

2

viability (d’Errico and Meyer-Luehmann 2020). Healthy cells may take up the tau aggregates or
they can be transferred via synapses and quickly invade healthy brain areas (d’Errico and MeyerLuehmann 2020).
Even though there is substantial evidence supporting the Aß and NFT hypotheses as hallmark
drivers of AD, studies have recently highlighted other mechanisms that may play an important role
in AD etiology. Increasing evidence suggests that cardiovascular health and, more recently, oral
health play an integral role in AD pathogenesis (de Bruijn and Ikram 2014; Kelleher and Soiza
2013; Ide et al. 2016).
1.2 Proliferation of Porphyromonas gingivalis in the oral cavity
The exact mechanism by which oral health is involved in AD pathology is not well known.
Multiple studies have found periodontal disease to be closely linked to the development of AD
(Ide et al. 2016; Dominy et al. 2019; Beydoun et al. 2020). Periodontal disease, also known as gum
disease, is one of the most widespread diseases in westernized countries, including North America,
and is thought to be the leading cause of tooth loss in older populations (Ide et al. 2016). It is a
gum infection that damages the tissues surrounding the teeth, due to the dysbiosis of the
commensal oral bacteria that leads to inflammation of the gingiva, the breakdown of connective
tissue, and the formation of periodontal pockets (Kinane et al. 2017; Leira et al. 2017). Periodontal
pockets are spaces around the teeth underneath the gum line that create an environment that favours
the proliferation of bacteria, particularly gram-negative species (Kamer et al. 2008).
Porphyromonas gingivalis is the keystone pathogen found in patients with periodontitis.
This bacterium typically exists in commensal harmony with the host; however, it can quickly shift
into a disease role if it excessively proliferates in the subgingival dental plaque (Lamont and
Jenkinson 1998; Guo et al. 2010). As a gram-negative anaerobic bacterium, P. gingivalis produces

3

toxic cysteine proteases that include lysine-gingipain (Kgp), arginine-gingipain A (RgpA), and
arginine-gingipain B (RgpB) (Dominy et al. 2019). Gingipains are characterized as narrowspectrum virulence targets; broad-spectrum antibiotics do not eliminate P. gingivalis and, instead,
add to its resistance. Gingipains contribute to 85% of proteolytic tissue destruction and enable a
tight adherence to sites in the oral cavity where they can exploit nutrients from- the host such as
heme and iron (Dominy et al. 2019; Guo et al. 2010). This increases nutrient delivery to dental
plaque communities, sustains chronic inflammation in the host gingival tissue, and induces
apoptosis of gingival epithelial cells (Shi et al. 1999; Guo et al. 2010; Stathopoulou et al. 2009;
Sheets et al. 2005). Gingipains are crucial in P. gingivalis pathology as they exploit host signalling
pathways to degrade extracellular protein matrixes, resist death by phagocytes, avoid host-induced
apoptosis, and alter the cytokine network to avoid host defence (Guo et al. 2010). Kgp and RgpA/B
are crucial to the pathogenicity of P. gingivalis and are involved in host colonization, suppression
of host defenses, nutrient acquisition, and tissue destruction (Dominy et al. 2019).
1.3 Proliferation of Porphyromonas gingivalis in the brain
Levels of this bacterium have also been found in the brains of patients with Alzheimer’s disease
suggesting that P. gingivalis, and the gingipains it produces, are involved in the pathophysiology
that leads to cognitive decline in this disease (Dominy et al. 2019; Ide et al. 2016; Poole et al.
2015; Singhrao et al. 2015). P. gingivalis residing within periodontal pockets enables it to have
easy access to the circulatory system and other parts of the body, such as the brain (Guo et al.
2010). In the brain, P. gingivalis moves from neuron to neuron, causing increased infection over
time, contributing to AD through several mechanisms (Dominy et al. 2019). The bacterium can
alter the function of monocytes and use them to travel to the circulatory system. Furthermore,
processes of bacteremia where bacteria can enter the bloodstream from gingival bleeding can also

4

induce the proliferation of bacteria in the circulatory system (Kanagasingam et al. 2020; Singhrao
et al. 2015; Dominy et al. 2019). P. gingivalis can then cross the permeable blood-brain barrier
and enter the brain via endothelial cells (Singhrao and Harding 2020). Another mechanism by
which P. gingivalis invasion of the brain may occur is through an olfactory or trigeminal cranial
nerve infection (Dominy et al. 2019). Furthermore, research has also suggested that the
inflammatory products produced in periodontal disease increase Aß and tau protein production in
brain tissue of patients with AD (Kamer et al. 2008; Ishida et al. 2017). Gingipains that are released
in the brain can cleave tau proteins therefore altering neuronal functioning and potentially
increasing cognitive decline (Dominy et al. 2019).
1.4 Gingipain inhibition
The link between P. gingivalis and AD has motivated researchers to try to treat P.
gingivalis associated AD. Because antibiotics are ineffective in treating P. gingivalis invasion,
small molecule gingipain inhibitors were developed (Dominy et al. 2019). Dominy et al. (2019)
found that directly inhibiting gingipain production using short peptide analogs decreases
colonization of the brain by P. gingivalis, therefore, reducing neurodegeneration in Alzheimer’s
disease. Kgp inhibitors have shown promise in reducing the amount and persistence of P.
gingivalis present in the brains of mice (Dominy et al. 2019). The study demonstrated that
gingipain inhibitors can decrease the amount of P. gingivalis in the brain, block gingipain-caused
neurodegeneration, decrease the Aß host response, and reduce overall neuroinflammation
(Dominy et al, 2019). The Kgp inhibitors also block the acquisition of host heme by P. gingivalis
– a process mediated by a unique hemophore, hmuY, that acts as a biomarker for P. gingivalis
(Smalley et al. 2007).

5

1.4.1 Nitrate supplementation
Another mechanism that may provide similar effects to that of gingipain inhibitors is the
administration of a dietary nitrate supplement. Researchers suggest the oral microbiome may be
altered by nitrate/nitrite presence, and the salivary composition can be altered via dietary nitrate
supplementation (Vanhatalo et al. 2018). The nitrate-nitrite-nitric oxide pathway relies on bacteria
within the oral microbiome to convert nitrate to nitrite, and this pathway may be an important
contributing factor to overall health (Vanhatalo et al. 2018). Nitric oxide is a vasodilator that is
utilized by the microbes in the oral cavity (Rosier et al. 2020). The production of nitric oxide via
nitrate supplementation causes systemic benefits including decreased blood pressure and arterial
stiffness, improved endothelial function, and reverses metabolic syndrome (Vanhatalo et al. 2018;
Rosier et al. 2020). Likewise, Rosier et al. (2020) suggested that nitrate could be used as a dietary
intervention to promote eubiosis in the oral microbiome.
Human cells lack NO3- reduction abilities; however, commensal bacteria residing in the
oral cavity use NO3- as a terminal electron acceptor in their metabolism by reducing NO3- to NO2and further to NO through the nitrate-nitrite-nitric reduction pathway (Vanhalato et al. 2018;
Dejam et al. 2004). In humans, upon NO3- ingestion up to 25% enters enterosalivary circulation
where it becomes concentrated in the saliva and anaerobic bacteria in the oral cavity are responhh
sible for the reduction of NO3- to NO2- (Wylie et al. 2013). When the NO2- enters the stomach, the
acidic environment converts some of the NO2- into NO and the rest is absorbed to increase NO2concentration in the circulating blood plasma (Wylie et al. 2013). NO is synthesized from Larginine by isoforms of the NO synthase and is involved in several important biological functions
including vascular tone regulation, immune response, and neurotransmission (Romitelli et al.

6

2007). Dietary nitrate supplementation can increase nitrite concentration in blood plasma and
serum and reduce resting blood pressure (Jones 2014).
In a previous study, we assessed the effects of a dietary nitrate supplementation on oral
microbial community composition and overall physiological health in a healthy study population.
We hypothesized that a dietary nitrate supplementation would reduce the abundance of P.
gingivalis, and improve secondary physiological outcomes tied to cardiovascular disease. To test
this hypothesis, a 10-day dietary nitrate supplementation was administered using potassium nitrate
to ten healthy participants. Using 16S rRNA gene sequencing, shifts in the oral microbial
community structure, specifically the abundance of P. gingivalis, were assessed, as well as
secondary physiological outcomes of blood pressure and endothelial function as markers of
cardiovascular disease risk.
Previously conducted studies have yielded promising data in reducing the abundance of P.
gingivalis present in the oral microbiome which subsequently reduces the production of gingipains.
The abundances of four target genes, kgp, hmuY, NarG (a nitrate reductase gene), and the 16SrRNA
gene for P. gingivalis, will be assessed in the current study. This work will build on a larger study
that examined the effect of nitrate supplementation on the abundance of P. gingivalis in the oral
microbiome and secondary physiological responses. To my knowledge, no other studies have
specifically analyzed the kgp, hmuY, and narG genes as well as the absolute abundance of P.
gingivalis in response to in vivo nitrate supplementation. We hypothesize that a reduction of P.
gingivalis in the oral microbiome could lower the risk of periodontitis and Alzheimer’s disease
and improve various cardiovascular and physiological responses. If improvements are seen in the
aforementioned factors, future studies can be conducted to assess the effects of nitrate

7

supplementation on those individuals with Alzheimer’s disease to see if there is a link between
oral microbiome dysbiosis and cognitive impairment.

2

MATERIALS AND METHODS

2.1 Ethical approval
Ethical approval was granted from the Thompson Rivers University Research Ethics Board
and Biosafety approval was granted by Thompson Rivers University Biosafety Committee. All
participants gave their written and informed consent, both after the experimental procedure and
risks had been explained to them and prior to the start of testing.
2.2 Study Participants
Ten healthy participants including seven males and three females between 20-49 years of
age were recruited to participate in the study. Recruitment was of Thompson Rivers University
professors and students, as to limit contact with the public due to the COVID-19 pandemic at the
time of testing. Participants were screened prior to testing to ensure they were suitable study
participants. All participants had their initial vaccination for COVID-19 (> 2 weeks prior to
testing), no blood or platelet/bleeding disorders, and no known cardiac diseases and/or
cardiovascular risk factors. None of the participants were hypertensive, smokers, diabetics, or had
other known metabolic diseases. The participants were not taking medication or treatment for any
disease, did not experience aversion to the sight of blood and/or needles, and were over 19 years
of age and under 49 years of age.
Preceding testing, participants were instructed to arrive at the laboratory rested, having
refrained from strenuous physical activity, alcohol, marijuana, or non-prescription drug ingestion
24 hours prior to sampling. They were instructed not to cycle or run to and from the laboratory on

8

sampling days, nor partake in any physically demanding work in the hours after the sampling day.
Participants were asked to avoid caffeine on the day of sampling before their testing, eating within
4 hours prior to sampling, and blood donations eight weeks prior to, and eight weeks after
participation. Additional participant exclusion criteria included using antimicrobial or antiseptic
tooth paste 48 hours prior to testing, mouthwash 48 hours prior to test, and flossing on the morning
of test days, as followed by criteria used in the NIH Human Microbiome Project.
2.3 Experimental Design
Participant testing consisted of blood pressure and ultrasonographic measurements, blood
extraction, and oral bacterial sampling, although only oral bacterial sampling is relevant to the
current project. Upon arrival to the lab, participants were placed in a supine position in a dimly lit,
temperature controlled (21-24C) room and were instrumented with a non-invasive continuous
blood pressure monitor. Once an adequate blood pressure signal was recording, the lights were
turned off and the participant was left in a supine position for ten minutes to ensure baseline
sampling was taken at rest, with minimal sympathetic nervous system activation.
Oral samples of floss were then taken and later subject to RNA extraction, rt-qPCR, and
qPCR to determine expression levels of kgp, hmuY, and narG genes as well as absolute abundance
of P. gingivalis. At the end of sampling, participants were given twenty 400 mg potassium nitrate
oral supplements to be taken twice a day for the 10 days preceding their post testing. Male
participants returned two weeks after their pre-testing for post testing, while females returned 28
days after their pre-testing to control for potential influences of the female menstrual cycle. In both
groups, the nitrate supplements were taken in the final 10 days preceding post supplement testing.
Upon return for post testing, the same above procedures were repeated.

9

2.4 Oral Bacteria Sampling
Following blood collection, oral floss samples were collected for microbial analysis, as per
methodology outlined in the NIH Human Microbiome Project – Core Microbiome Sampling
Protocol and altered where necessary.
2.4.1 Hard tissue floss
A hard tissue gum line sample was obtained by flossing. Participants were instructed to
floss four teeth, each twice, with sterile disposable floss picks for a total of eight floss samples.
The teeth flossed were between each canine and first premolar in the top right, bottom right, top
left, and bottom left areas of the mouth. The floss of each pick was removed with a sterile razor
and all eight floss samples were placed together in a 2 mL screw top tube containing 1 g sterile
ceramic beads and 600 µL Buffer RLT Plus. If participants bled during flossing, the floss was
disposed, and they were instructed to floss between the first and second premolar of the same area
instead (e.g., top right). The tube was then flash frozen in liquid nitrogen and stored at
-80°C until further DNA analysis.
2.5 RNA Isolation
Hard tissue floss samples from both pre and post nitrate supplementation of the 10
participants were isolated using an AllPrep DNA/RNA Mini Kit (Qiagen, Hilden, Germany).
Samples were frozen in Buffer RLT Plus and were stored in tubes containing 1 g of sterile silica
beads. Once all samples were thawed, 6 µL of beta-mercaptoethanol (BME) was added to each
sample, homogenized by bead beating (vortexing) for 5 minutes, and centrifuged at 8000 rpm for
30 seconds following the methodology outlined by Moen et al. (2016). From then onwards,
manufacturer’s instructions were followed. Once the RNA had been extracted, it was quantified
using a Qubit 2.0 Fluorometer (Invitrogen, Carlsbad, CA, USA).

10

Figure 1. Methodology and timeline showing how the RNA extracts were obtained from the
previous study conducted by Freeze et al. (2022).

2.6 RNA Quantification
A quantification of the 20 floss RNA extracts was carried out using the Qubit 2.0
Fluorometer (Invitrogen, Carlsbad, CA, USA) and QubitTM RNA HS Assay Kit (Thermo Fisher
Scientific, Massachusetts, USA).
2.7 Reverse Transcriptase Polymerase Chain Reaction
Reverse transcriptase polymerase chain reaction (RT PCR) was carried out on 20 floss
RNA extracts using the SuperScriptTM IV VILOTM Master Mix (Invitrogen, Carlsbad, CA, USA).
Genomic DNA digests were prepared for each of the samples containing 1 uL 10X ezDNAse
buffer, 1 µL ezDNAse enzyme, 6 µL nuclease-free water, and 2.5 µg RNA to a final volume of
10µL in microcentrifuge tubes. The tubes were incubated at 37°C for 2 minutes and subsequently
centrifuged and placed on ice. Reverse transcription and non-reverse transcription template
controls were prepared using 4 µL SuperScriptTM IV VILOTM Master Mix and SuperScriptTM IV
VILOTM No RT Control respectively and 6 µL nuclease-free water to a final volume of 10 µL in

11

microcentrifuge tubes. PCR thermocycling conditions included: primer annealing for 10 minutes
at 25°C; reverse transcription for 10 minutes at 50°C; and enzyme inactivation for 5 minutes at
85°C. Reverse transcription was assessed in all samples and controls by running 5 μL of product
on a 1% agarose gel prepared in TAE buffer, and product sizes were determined by comparison to
500 ng of 1 kb Plus Ladder run on the same gel. The gel was run at 70 volts for 25 minutes and
visualized on a UV transilluminator.
2.8 Primer and Probe Design
2.8.1 Acquiring Sequences from the National Centre for Biotechnology Information (NCBI)
For kgp, approximately 10 sequences were selected in P. gingivalis strains from NCBI and
subsequently parsed. BLAST was run to find similar sequences, and the FASTA file was acquired
and uploaded to Geneious Prime. For hmuY, approximately 10 sequences were selected in P.
gingivalis strains from NCBI and subsequently parsed. BLAST was run to find similar sequences,
and the FASTA file was acquired and uploaded to Geneious Prime. For the 16SrRNA gene, only
1 sequence for 1 strain of P. gingivalis was found on NCBI and BLAST was run to find similar
sequences, and the FASTA file was acquired and uploaded to Geneious Prime. For kgp,
approximately 10 sequences were selected in P. gingivalis strains from NCBI and subsequently
parsed. BLAST was run to find similar sequences, and the FASTA files were acquired and
uploaded to Geneious Prime. For narG, approximately 10 sequences were selected and parsed in
strains from Actinomyces, Corynebacterium, Kingella, Rothia, and Veillonella, which were the
genera that were most abundant in the DNA samples from the previous study conducted by Freeze
et al. (2022). BLAST was run to find similar sequences, and the FASTA files were acquired and
uploaded to Geneious Prime.

12

Table 1. Summary of the four gene targets in which primers and probes will be designed for qPCR.
Target Gene
Target Bacteria
Analysis
16SrRNA
Porphyromonas gingivalis
absolute abundance of P.gingivalis
present in samples

kgp

Porphyromonas gingivalis

abundance of gingipains present in
samples

hmuY

Porphyromonas gingivalis

abundance of iron acquisition genes
in samples; hmuY codes for a
hemophore unique to P. gingivalis

narG

Veillonella sp. Actinomyces sp.,
abundance of nitrate reducing genes
Corynebacterium sp., Kingella sp., present in the samples; measures the
Rothia sp., and Veillonella sp.
expression of nitrate reducers in
response to the supplementation

2.8.2 Geneious Prime Software
FASTA files acquired from NCBI were uploaded to Geneious Prime Software and aligned
using Multiple Sequence Comparison by Log-Expectation (MUSCLE) parameters. Primers and
probes were designed and selected on conserved regions of the genome, as well as based on
parameters size as target size of amplicon (50-150bp), length (18-21 nucleotides) melting
temperature (60-80°C), and GC content (approximately 50%). Three primer and probe
combinations were selected for each of the four genes of interest (Table 1).
2.9 Amplification using Polymerase Chain Reaction
2.9.1 Amplification of the kgp gene
Polymerase chain reaction (PCR) of the kgp gene was carried out on extracted DNA
samples from the previous study (Freeze et al. 2022) to test the targets. A 20 μL reaction mixture
was prepared in a microcentrifuge tube containing a final concentration of 1X GoTaq Green Master

13

Mix (Promega, Madison, USA), 0.05 μM forward primer (80F ATGCTCCGACTACTCGAA,
362F TGCCACATCAACCCTCTA, or 2436F AGGACAGGGTGAAGTTGT), 0.05 μM reverse
primer (183R ACCTTTGGTCTCCACCTT, or 437F GCATAAGCAGCAGCATTG, or 2516R
CACATCTTTCCGGATGCA), and 2 μL isolated DNA from each sample. In place of the 2 μL
DNA sample, 2 μL of P. gingivalis stock (AlphaDNA) was used as a positive control and 2 μL of
PCR-grade water as a negative control. Each 20 μL reaction mixture was transferred to a well in a
96-well PCR plate and PCR was completed in a SimpliAmp Thermal Cycler (Thermo Fisher
Scientific, Massachusetts, USA). PCR thermocycling conditions included: an initial denaturation
for 10 minutes at 95°C; 40 cycles of denaturation for 15 seconds at 95°C, primer annealing for 1
minute at 60°C; and a final extension for 5 minutes at 72°C. PCR amplification was assessed in
all samples and controls by running 5 μL of product on a 2% agarose gel prepared in TAE buffer,
and product sizes were determined by comparison to 500 ng of 1 kb Plus Ladder run on the same
gel. The gel was run at 80 volts for 90 minutes and visualized on a UV transilluminator.
2.9.2 Amplification of the hmuY gene
Polymerase chain reaction (PCR) of the hmuY gene was carried out on extracted DNA
samples from the previous study (Freeze et al. 2022) to test the targets. A 20 μL reaction mixture
was prepared in a microcentrifuge tube containing a final concentration of 1X GoTaq Green Master
Mix

(Promega,

Madison,

USA),

CCACTTTCGCCACAATTGAGACA,

0.05

496F

TTTGGTTACTGCTTCGGG),

0.05

AATACGAAACGTGGCAGTTCG,

or

forward

primer

ACTGCCACGTTTCGTATT,
μM

627R

μM

reverse

(384F

or

primer

TCTGTGCATTGCCATTGA,

536F
(513R

or

639R

TTTTCTCCGCACTCTGTG), and 2 μL isolated DNA from each sample. In place of the 2 μL
DNA sample, 2 μL of P. gingivalis stock (AlphaDNA) was used as a positive control and 2 μL of

14

PCR-grade water as a negative control. Each 20 μL reaction mixture was transferred to a well in a
96-well PCR plate and PCR was completed in a SimpliAmp Thermal Cycler (Thermo Fisher
Scientific, Massachusetts, USA). PCR thermocycling conditions included:
an initial denaturation for 10 minutes at 95°C; 40 cycles of denaturation for 15 seconds at 95°C,
primer annealing for 1 minute at 60°C; and a final extension for 5 minutes at 72°C. PCR
amplification was assessed in all samples and controls by running 5 μL of product on a 2% agarose
gel prepared in TAE buffer, and product sizes were determined by comparison to 500 ng of 1 kb
Plus Ladder run on the same gel. The gel was run at 80 volts for 90 minutes and visualized on a
UV transilluminator.
2.9.3 Amplification of the NarG gene
Polymerase chain reaction (PCR) of the narG gene was carried out on extracted DNA
samples from the previous study (Freeze et al. 2022) to test the targets. A 20 μL reaction mixture
was prepared in a microcentrifuge tube containing a final concentration of 1X GoTaq Green Master
Mix (Promega, Madison, USA), 0.05 μM forward primer (2383F CTGTATGCCGACGTGATT,
2433F CTTGAACACGTCCGACAT, or 3251F CCGCCAGCATTTCTATCA), 0.05 μM reverse
primer (2515R CCCAGTCGGATTTGCTTTCCGTG, or 2513R CAGTCGGATTTGCTTTGC, or
3361R TTCATGCCCAGCAGTTTT), and 2 μL isolated DNA from each sample. In place of the
2 μL DNA sample, 2 μL of P. gingivalis stock (AlphaDNA) was used as a positive control and 2
μL of PCR-grade water as a negative control. Each 20 μL reaction mixture was transferred to a
well in a 96-well PCR plate and PCR was completed in a SimpliAmp Thermal Cycler (Thermo
Fisher Scientific, Massachusetts, USA). PCR thermocycling conditions included: an initial
denaturation for 10 minutes at 95°C; 40 cycles of denaturation for 15 seconds at 95°C, primer
annealing for 1 minute at 60°C; and a final extension for 5 minutes at 72°C. PCR amplification

15

was assessed in all samples and controls by running 5 μL of product on a 2% agarose gel prepared
in TAE buffer, and product sizes were determined by comparison to 500 ng of 1 kb Plus Ladder
run on the same gel. The gel was run at 80 volts for 90 minutes and visualized on a UV
transilluminator.
2.9.4 Amplification of the 16SrRNA gene
Polymerase chain reaction (PCR) of the 16SrRNA gene was carried out on extracted DNA
samples from the previous study (Freeze et al. 2022) to test the targets. A 20 μL reaction mixture
was prepared in a microcentrifuge tube containing a final concentration of 1X GoTaq Green Master
Mix (Promega, Madison, USA), 0.05 μM forward primer (226F TAAGATAGGCATGCGTCC,
582F GTTGTTCGGTAAGTCAGC, or 1177F GGTGTGGATGACGTCAAT), 0.05 μM reverse
primer (319R AGTGTGGGGGATAAACCT, or 721R AATCGGAGTTCCTCGTGA, or 1294R
TGGGGAAGGGTTTAGAGA), and 2 μL isolated DNA from each sample. In place of the 2 μL
DNA sample, 2 μL of P. gingivalis stock (AlphaDNA) was used as a positive control and 2 μL of
PCR-grade water as a negative control. Each 20 μL reaction mixture was transferred to a well in a
96-well PCR plate and PCR was completed in a SimpliAmp Thermal Cycler (Thermo Fisher
Scientific, Massachusetts, USA). PCR thermocycling conditions included: an initial denaturation
for 10 minutes at 95°C; 40 cycles of denaturation for 15 seconds at 95°C, primer annealing for 1
minute at 60°C; and a final extension for 5 minutes at 72°C. PCR amplification was assessed in
all samples and controls by running 5 μL of product on a 2% agarose gel prepared in TAE buffer,
and product sizes were determined by comparison to 500 ng of 1 kb Plus Ladder run on the same
gel. The gel was run at 80 volts for 90 minutes and visualized on a UV transilluminator.

16

Figure 2. Primers and probes were designed to target regions of the cDNA for subsequent
quantitative polymerase chain reaction (qPCR).

3

RESULTS

3.1 Primer and Probe Combinations from Geneious Prime
Primer and probe combinations were designed and specified in Geneious Prime software.
Primers and probes were designed and selected on conserved regions of the genome, as well as
based on parameters size as target size of amplicon (50-150bp), length (18-21 nucleotides) melting
temperature (60-80°C), and GC content (approximately 50%). Three primer and probe
combinations were selected for each of the four genes of interest (Table 1).
Table 1. Primer and probe combinations selected for testing using polymerase chain reaction
(PCR).
Target Gene
Forward Primer
Probe
Reverse Primer
16SrRNA 226F TAAGATAGGCATGCGTCC
276P AGGCGACGATGGGTAGGGGAA
319R AGTGTGGGGGATAAACCT
582F GTTGTTCGGTAAGTCAGC
1177F GGTGTGGATGACGTCAAT

kgp

80F ATGCTCCGACTACTCGAA
362F TGCCACATCAACCCTCTA
2436F AGGACAGGGTGAAGTTGT

hmuY

384F CCACTTTCGCCACAATTGAGACA
496F ACTGCCACGTTTCGTATT
536F TTTGGTTACTGCTTCGGG

narG

2383F CTGTATGCCGACGTGATT
2433F CTTGAACACGTCCGACAT
3251F CCGCCAGCATTTCTATCA

643P CCGGGCTTGAGTTCAGCGGC
1236P TGGGAGGGACAATGGGCAGCT

721R AATCGGAGTTCCTCGTGA
1294R TGGGGAAGGGTTTAGAGA

123P GCAGTTCGATGCAAGCTTTTCGTTCA
183R ACCTTTGGTCTCCACCTT
390P TGATGATCCCGAAAAGGTTCCCTTCGT 437R GCATAAGCAGCAGCATTG
2457P CCCCGGTGGTGTTTACGACTATTGCA 2516R CACATCTTTCCGGATGCA
416P GCGGTGAAGAGCCATGTCCCA 513R AATACGAAACGTGGCAGTTCG
556P ACTGCCACGTTTCGTATT
627R TCTGTGCATTGCCATTGA
556P TGGAGGGTTGGTTCGGCTCGT
639R TTTTCTCCGCACTCTGTG

2438P ACACGTCCGACATGCACCCGT 2515R CCCAGTCGGATTTGCTTTCCGTG
2451P GCACCCGTTCATCCACCCGT
2513R CAGTCGGATTTGCTTTGC
3308P TGCCTACCGTCCCGCAGTCG
3361F TTCATGCCCAGCAGTTT

17

3.2 Reverse Transcriptase Polymerase Chain Reaction
Results from the agarose gels confirm that reverse transcription was successful in all 20 floss
samples (10 pre- and 10 post-nitrate supplementation) (Figure 3, 4, 5, & 6). Product sizes were
determined in samples and controls by comparing the amplified regions to 500 ng of 1 kb Plus

P05 pre (No RT)

P05 pre (RT)

P04 pre (No RT)

P04 pre (RT)

P03 pre (No RT)

P03 pre (RT)

P02 pre (No RT)

P02 pre (RT)

P01 pre (No RT)

P01 pre (RT)

+ve control
-ve control

1KB ladder

Ladder.

Figure 3. Agarose gel confirming the reverse transcription of the RNA samples (P01pre-P05pre)
using reverse transcriptase polymerase chain reaction. +ve = positive; -ve = negative; RT = reverse
transcription

18

P10 pre (No RT)

P10 pre (RT)

P09 pre (No RT)

P09 pre (RT)

P08 pre (No RT)

P08 pre (RT)

P07 pre (No RT)

P07 pre (RT)

P06 pre (No RT)

P06 pre (RT)

+ve control
-ve control

1KB ladder

P05 post (No RT)

P05 post (RT)

P04 post (No RT)

P04 post (RT)

P03 post (No RT)

P03 post (RT)

P02 post (No RT)

P02 post (RT)

P01 post (No RT)

P01 post (RT)

+ve control
-ve control

1KB ladder

Figure 4. Agarose gel confirming the reverse transcription of the RNA samples (P06pre-P10pre)
using reverse transcriptase polymerase chain reaction. +ve = positive; -ve = negative; RT = reverse
transcription

Figure 5. Agarose gel confirming the reverse transcription of the RNA samples (P01post-P05post)
using reverse transcriptase polymerase chain reaction. +ve = positive; -ve = negative; RT = reverse
transcription

19

P10 post (No RT)

P10 post (RT)

P09 post (No RT)

P09 post (RT)

P08 post (No RT)

P08 post (RT)

P07 post (No RT)

P07 post (RT)

P06 post (No RT)

P06 post (RT)

+ve control
-ve control

1KB ladder

P02 post (RT)

Figure 6. Agarose gel confirming the reverse transcription of the RNA samples (P01post-P05post)
using reverse transcriptase polymerase chain reaction. +ve = positive; -ve = negative; RT = reverse
transcription

20

3.3 Primer Combination Testing
3.3.1 kgp
Results from the agarose gel shows presence of amplified regions of target sizes in the positive
control lanes (P. gingivalis stock; Alpha DNA) for all three primer/sets – 80F/183R, 362F/437F,
and 2436F/2516R. This suggests that the kgp gene was amplified using all three sets. Sanger
sequencing on the gel bands can be done to confirm their identity and the specificity of the primers

80F/183R

362F/437R

cDNA
Practice DNA (01)
Practice DNA (02)

+ve control
-ve control

Practice DNA (02)

Practice DNA (01)

+ve control
-ve control
cDNA

Practice DNA (02)

Practice DNA (01)

+ve control
-ve control
cDNA

1kb Ladder

(Figure 7).

2436F/2516R

Figure 7. Agarose gel confirming the amplification of kgp with the 80F/183R, 362F/437R, and
2436F/2516R primer sets. +ve = positive; -ve = negative

3.3.2 hmuY
Results from the agarose gel shows presence of an amplified region of target size in the positive
control lane (P. gingivalis stock; Alpha DNA) for one of the primer/sets – 384F/513R. This

21

suggests that the hmuY gene was amplified using this set. Sanger sequencing on the gel band can

384F/513R

496F/627R

cDNA
Practice DNA (01)
Practice DNA (02)

+ve control
-ve control

Practice DNA (02)

Practice DNA (01)

+ve control
-ve control
cDNA

Practice DNA (02)

Practice DNA (01)

+ve control
-ve control
cDNA

1kb Ladder
50bp Ladder

be done to confirm its identity and the specificity of the primers (Figure 8).

536F/639R

Figure 8. Agarose gel confirming the amplification of hmuY with the 384F/513R primer set. +ve
= positive; -ve = negative

3.3.3 narG
Results from the agarose gel shows presence of an amplified region of target size in the positive
control lane (P. gingivalis stock; Alpha DNA) for one of the primer/sets – 2383F/2515R. This
suggests that the narG gene was amplified using this set. Sanger sequencing on the gel band can
be done to confirm its identity and the specificity of the primers (Figure 9).

22

Figure 9. Agarose gel confirming the amplification of narG with the 2383F/2515R primer set.
+ve = positive; -ve = negative

3.3.4 16SrRNA
Results from the agarose gel does not show presence of amplified regions of target size in
the positive control lane (P. gingivalis stock; Alpha DNA) for any of the primer/sets. This suggests
that the 16SrRNA gene was not amplified.

3.3.5 Primer and Probe Combinations that Demonstrated Amplification
A total of 5 primer and probe combinations showed amplification of the expected target
size suggesting that they are amplifying the gene of interest (Table 2). These primer and probe
combinations will be further utilized on the cDNA samples in qPCR.

23

Table 2. Primer and probe combinations selected for quantitative polymerase chain reaction
(qPCR).
Target Gene
Primer/Probe Combination
kgp
80F/123P/183R
362F/390P/437R
2436F/2457P/2516R

4

hmuY

384F/416P/513R

narG

2383F/2438P/2515R

DISCUSSION
This study designed and validated primers and probes for qPCR to assess the expression levels

of hmuY, kgp, and narG in human oral microbiome cDNA samples. Quantitative polymerase chain
reaction (qPCR) allows us to not only amplify regions of DNA but to quantify abundance of
specific genes in a sample. We found that hmuY, kgp, and narG were amplified of correct size in
the positive control samples (100 ng/µL stock P. gingivalis, AlphaDNA), suggesting that the
primer targets are accurate. This work will lay foundation for quantifying the absolute abundance
of P. gingivalis and the expression levels of hmuY, kgp, and narG in the cDNA samples using
qPCR, and, overall, how nitrate supplementation affects these abundances. Additionally, results
from the qPCR analysis will give us more precise measurements of how much Porphyromonas sp.
are present in the samples which can then be compared to the physiological responses to nitrate
supplementation from the study conducted by Freeze et al. (2022). A reduction of P. gingivalis in
the oral microbiome could lower the risk of periodontitis and Alzheimer’s disease and improve
various cardiovascular and physiological responses.

24

4.1 Primer Design
Quantitative polymerase chain reaction (qPCR) is a tool used for analysis and quantification
of gene expression. It is advantageous because data can be viewed in real time using a computer;
a fluorescent dye is incorporated via a probe which intercalates with the amplified region of interest
(Thornton and Basu 2015; Higuchi et al. 1993). The most common probe systems used today are
Molecular Beacon®, SYBR Green®, and Taqman®; however, the success of qPCR amplfication
and quantification are dependent on primers and probes used (Thornton and Basu 2015). Geneious
Prime is a program for testing the design and specificity of primer pairs for qPCR for use in lowto high-throughput transcript profiling experiments (Arvidsson et al. 2008; Higuchi et al. 1993).
Considerations for primer design in this study include GC content (approximately 50%), target
size of amplicon (50-150 bp), length (18-21 nucleotides, and melting temperature (60-80°C). Other
parameters such as primer self-dimer and secondary structure formation are also important
considerations (Thornton and Basu 2015).
4.1.1 kgp and hmuY
Kgp inhibitors block the acquisition of host heme by P. gingivalis (Smalley et al. 2007).
Results from the agarose gel for kgp show presence of amplified regions of target sizes in the
positive control lanes for three primer/sets tested – 80F/183R, 362F/437F, and 2436F/2516R. This
suggests that the kgp gene was amplified using all three sets (Figure 7). hmuY is the gene
responsible for heme acquisition in P. gingivalis. Results from the agarose gel for hmuY show
presence of an amplified region of target size in the positive control lane for one of the primer/sets
tested – 384F/513R. This suggests that the hmuY gene was amplified using this set. Sanger
sequencing on the gel band can be done to confirm its identity and the specificity of the primers
(Figure 8).

25

4.1.2 narG
Gene

sequences

related

to

the

enzymes

involved

in

nitrate

reduction

(napA, narG, nirK, nirS, nosZ, nrfA) have been isolated and have been shown to differ
significantly from previously recorded sequences (Papaspyrou, 2014). A study conducted by
Papaspyrou et al. suggested that NAR was proportionally more important than NAP and can be
more easily targeted with qPCR probes (2014). Results from the agarose gel for narG show
presence of an amplified region of target size in the positive control lane (P. gingivalis stock;
Alpha DNA) for one of the primer/sets – 2383F/2515R. This suggests that the narG gene was
amplified using this set. Sanger sequencing on the gel band can be done to confirm its identity and
the specificity of the primers (Figure 9).
4.1.3 16SrRNA
Results from the agarose gel does not show presence of amplified regions of target size in the
positive control lane (P. gingivalis stock; Alpha DNA) for any of the primer/sets. This suggests
that the 16SrRNA gene was not amplified. The 16SrRNA gene is one that is present in all
prokaryotic life, so it was expected that we could amplify this gene in the clinical samples.
However, there are a couple of reasons that can be speculated as to why we could not obtain
amplified product. When compiling sequences for the 16SrRNA gene for P. gingivalis only one
strain was acquired. This increases the specificity of the primer; however, it decreases the
likelihood of targeting the strain of P. gingivalis present in the samples meaning that it is likely
that the specific strain is not present and was not amplified. It is also possible that the concentration
of P. gingivalis is too low in the samples and cannot be amplified with the chosen primer sets.

26

4.2 Conclusions and Future Work
Identifying potential treatments and preventative measures for AD is becoming of increasing
concern with its more prevalent detection worldwide. Links between oral health and overall health
are also being studied to a greater degree; Porphyromonas gingivalis is a bacterium that exists in
the oral cavity and has been linked to AD pathology (Dominy et al. 2019). A dietary nitrate
supplement has been suggested to reduce the abundance of P. gingivalis in the oral cavity, and,
thus, potentially provide protection against the progression of AD in individuals (Dominy et al.
2019). In the previous study, significant differences in vascular health, oral microbiome
composition, or the abundance of Porphyromonas after a 10-day nitrate were not observed (Freeze
et al. 2022). However, it was found that the microbiome associated with each sample type was
closely related among individuals, the oral microbiome composition remains relatively stable over
time, and the largest relative abundance of Porphyromonas sp. is found in floss samples as
compared to other sample types (Freeze et al. 2022). With the methodology presented here, it is
hypothesized that we can increase the specificity of the assay and obtain more precise
measurements of the absolute abundance of P. gingivalis in the samples as well as the expression
levels of hmuY, kgp, and narG which are key players in the metabolism of P. gingivalis and nitrate
reduction. This has the potential to be developed into a larger scale study where we could pursue
a larger sample size and explore the usage of different nitrate sources to provide further insight
into how vascular health and the oral microbiome respond to chronic nitrate supplementation. This
study designed novel primers and probes to specifically target kgp, hmuY, and narG in response
to in vivo nitrate supplementation which opens up new avenues of research with regard to the
aforementioned genes and P. gingivalis. Studies can be conducted to assess the effects of nitrate
supplementation on those individuals with Alzheimer’s disease to see if there is a link between

27

oral microbiome dysbiosis and cognitive impairment. If future studies see improvements post
nitrate supplementation in overall health, the use of a dietary nitrate supplement could potentially
be administered to people suffering from cognitive impairment, with the hope of it reducing the
symptoms of Alzheimer’s disease.

28

5

LITERATURE CITED

Anand KS, Dhikav V. 2012. Hippocampus in health and disease: An overview. Ann Indian Acad
Neurol. 15(4): 239-246. doi: 10.4103/0972-2327.104323.
Armstrong RA. 2013. What causes Alzheimer's disease? Folia Neuropathol. 51(3): 169-188. doi:
10.5114/fn.2013.37702.
Arvidsson S, Kwasniewski M, Riaño-Pachón DM, Mueller-Roeber B. 2008. QuantPrime – a
flexible tool for reliable high-throughput primer design for quantitative PCR. BMC
Bioinformatics 9(465). doi: 10.1186/1471-2105-9-465
Beydoun MA, Beydoun HA, Hossain S, El-Hajj ZW, Weiss J, Zonderman AB. 2020. Clinical and
Bacterial Markers of Periodontitis and Their Association with Incident All-Cause and
Alzheimer's Disease Dementia in a Large National Survey. J Alzheimer’s Dis. 75(1): 157172. doi: 10.3233/JAD-200064.
Chen, G, Xu T, Yan Y, Zhou Y, Jiang Y, Melcher K, Xu HE. 2017. Amyloid beta: structure,
biology and structure-based therapeutic development. Acta Pharmacol Sin. 38: 1205-1235.
doi: 10.1038/aps.2017.28.
d’Errico P, Meyer-Luehmann M. 2020. Mechanisms of Pathogenic Tau and Aβ Protein Spreading
in Alzheimer’s Disease. Front Aging Neurosci. 12: 265. doi: 10.3389/fnagi.2020.00265.
de Bruijn RF, Ikram MA. 2014. Cardiovascular risk factors and future risk of Alzheimer's disease.
BMC Med. 12: 130. doi: 10.1186/s12916-014-0130-5.
Dejam A, Hunter CJ, Schechter AN, Gladwin MT. 2004. Emerging role of nitrite in human
biology. Blood Cells Mol Dis. 32(3): 423-429. doi: 10.1016/j.bcmd.2004.02.002.
Dominy SS, Lynch C, Ermini F, Benedyk M, Marczyk A, Konradi A, Nguyen M, Haditsch U,
Raha D, Griffin C, et al. 2019. Porphyromonas gingivalis in Alzheimer’s disease brains:
Evidence for disease causation and treatment with small-molecule inhibitors. Sci Adv.
5(1): 122. doi: 10.1126/sciadv.aau3333.
Freeze GE, Reudink M, Bottos EM, Rakobowchuk ME. 2022 The effect of nitrate supplementation
on Porphyromonas gingivalis abundance in the oral microbial community. Honours
Thesis. unpublished.
Glenner GG, Wong CW. 1984. Alzheimer's disease: initial report of the purification and
characterization of a novel cerebrovascular amyloid protein. Biochem Biophys Res
Commun. 120(3): 885-890. doi: 10.1016/s0006-291x(84)80190-4.
Gosztyla ML, Brothers HM, Robinson SR. 2018. Alzheimer's Amyloid-β is an Antimicrobial
Peptide: A Review of the Evidence. J Alzheimers Dis. 62(4): 1495-1506. doi:
10.3233/JAD-171133.

29

Guo Y, Nguyen K, Potempa J. 2010. Dichotomy of gingipains action as virulence factors: from
cleaving substrates with the precision of a surgeon's knife to a meat chopper-like brutal
degradation of proteins. Periodontal. 54(1): 15-44. doi: 10.1111/j.16000757.2010.00377.x.
Higuchi R, Fockler C, Dollinger G, Watson R. 1993. Kinetic PCR analysis: real-time monitoring
of DNA amplification reactions. Nat Biol Technol. 11: 1026-1030.
Ide M, Harris M, Stevens A, Sussams R, Hopkins V, Culliford D, Fuller J, Ibbett P, Raybould R,
Thomas R, et al. 2016. Periodontitis and Cognitive Decline in Alzheimer’s Disease. PLoS
One. 11(3): e0151081. doi: 10.1371/journal.pone.0151081.
Ishida N, Ishihara Y, Ishida K, Tada H, Funaki-Kato Y, Hagiwara M, Ferdous T, Abdullah M,
Mitani A, Michikawa M, et al. 2017. Periodontitis induced by bacterial infection
exacerbates features of Alzheimer's disease in transgenic mice. NPJ Aging Mech Dis. 3:15.
doi: 10.1038/s41514-017-0015-x.
Kamer AR, Craig RG, Dasanayake AP, Brys M, Glodzik-Sobanska L, de Leon MJ. 2008.
Inflammation and Alzheimer's disease: possible role of periodontal diseases. Alzheimer’s
Dement. 4(4): 242-250. doi: 10.1016/j.jalz.2007.08.004.
Kametani F, Hasegawa M. 2018. Reconsideration of Amyloid Hypothesis and Tau Hypothesis in
Alzheimer's Disease. Front Neurosci. 12: 25. doi: 10.3389/fnins.2018.00025.
Kanagasingam S, Chukkapalli SS, Welbury R, Singhrao SK. 2020. Porphyromonas gingivalis is
Strong Risk Factor for Alzheimer's Disease. J Alzheimer’s Dis Rep. 4(1): 501-511. doi:
10.3233/ADR-200250.
Kelleher RJ, Soiza RL. 2013. Evidence of endothelial dysfunction in the development of
Alzheimer's disease: Is Alzheimer's a vascular disorder? Am J Cardiovasc Dis. 3(4): 197226.
Kinane DF, Stathopoulou PG, Papapanou PN. 2017. Periodontal diseases. Nat Rev Dis Primers.
3: 17038. doi: 10.1038/nrdp.2017.38.
Kumar DK, Choi SH, Washicosky KJ, Eimer WA, Tucker S, Ghofrani J, Lefkowitz A, McColl G,
Goldstein LE, Tanzi RE, et al. 2017. Amyloid-β peptide protects against microbial
infection in mouse and worm models of Alzheimer's disease. Sci Transl Med. 8(340):
340ra72. doi: 10.1126/scitranslmed.aaf1059.
Lamont RJ, Jenkinson HF. 1998. Life below the gum line: pathogenic mechanisms of
Porphyromonas gingivalis. Microbiol Mol Biol Rev. 62(4): 1244-1263. doi:
10.1128/MMBR.62.4.1244-1263.1998.

30

Leira Y, Dom.nguez C, Seoane J, Seoane-Romero J, P.as-Peleteiro JM, Takkouche B, Blanco J,
Aldrey JM. 2017. Is Periodontal Disease Associated with Alzheimer's Disease? A
Systematic Review with Meta-Analysis. Neuroepidemiology. 48(1-2): 21-31.
doi:10.1159/000458411.
Lundberg J, Weitzberg E, Gladwin M. 2008. The nitrate–nitrite–nitric oxide pathway in
physiology and therapeutics. Nat Rev Drug Discov. 7: 156–167. doi: 10.1038/nrd2466.
Medeiros R, Baglietto-Vargas D, LaFerla FM. 2011. The role of tau in Alzheimer's disease and
related disorders. CNS Neurosci Ther. 17(5): 514-524. doi: 10.1111/j.17555949.2010.00177.x.
Moen AE, Tann.s TM, Vatn S, Ricanek P, Vatn MH, Jahnsen J, IBD-Character Consortium. 2016.
Simultaneous purification of DNA and RNA from microbiota in a single colonic mucosal
biopsy. BMC Res Notes. 9: 328. doi: 10.1186/s13104-016-2110-7.
Murphy MP, LeVine H III. 2010. Alzheimer's disease and the amyloid-beta peptide. J Alzheimer’s
Dis. 19(1): 311-23. doi: 10.3233/JAD-2010-1221.
NIH Human Microbiome Project – Core Microbiome Sampling Protocol. 2010. Human
Microbiome Project Consortium. https://www.ncbi.nlm.nih.gov/projects/gap/cgibin/
document.cgi?study_id=phs000228.v3.p1&phd=3190#sec1
Papaspyrou S, Smith CJ, Dong LF, Whitby C, Dumbrell AJ, Nedwell DB. 2014. Nitrate reduction
functional genes and nitrate reduction potentials persist in deeper estuarine sediments.
Why? PLoS One. 9(4). doi: 10.1371/journal.pone.0094111
Raji CA, Lopez OL, Kuller LH, Carmichael OT, Becker JT. 2009. Age, Alzheimer disease, and
brain structure. Neurology. 73(22): 1899-905. doi: 10.1212/WNL.0b013e3181c3f293.
Romitelli F, Santini SA, Chierici E, Pitocco D, Tavazzi B, Amorini AM, Lazzarino G, Di Stasio
E. 2007. Comparison of nitrite/nitrate concentration in human plasma and serum samples
measured by the enzymatic batch Griess assay, ion-pairing HPLC and ion-trap GC-MS:
the importance of a correct removal of proteins in the Griess assay. J Chromatogr B Analyt
Technol Biomed Life Sci. 851(1-2): 257-267. doi: 10.1016/j.jchromb.2007.02.003.
Rosier BT, Buetas E, Moya-Gonzalvez EM, Artacho A, Mira A. 2020. Nitrate as a potential
prebiotic for the oral microbiome. Sci Rep. 10(1): 1-15. doi: 10.1038/s41598-020-69931x.
Santos CY, Snyder PJ, Wu WC, Zhang M, Echeverria A, Alber J. 2017. Pathophysiologic
relationship between Alzheimer's disease, cerebrovascular disease, and cardiovascular risk:
A review and synthesis. Alzheimer’s Dement. 7: 69-87. doi: 10.1016/j.dadm.2017.01.005.

31

Sheets SM, Potempa J, Travis J, Casiano CA, Fletcher HM. 2005. Gingipains from
Porphyromonas gingivalis W83 induce cell adhesion molecule cleavage and apoptosis in
endothelial cells. Infect Immun. 73(3): 1543-1552. doi: 10.1128/IAI.73.3.1543-1552.2005.
Singhrao SK, Harding A, Poole S, Kesavalu L, Crean S. 2015. Porphyromonas gingivalis
periodontal infection and its putative links with Alzheimer’s disease. Mediators Inflamm.
137357. doi: 10.1155/2015/137357.
Singhrao SK, Harding A. 2020. Is Alzheimer’s disease a polymicrobial host microbiome
dysbiosis?
Expert
Rev
Anti
Infect
Ther.
18(4):
275-277.
doi:
10.1080/14787210.2020.1729741.
Smalley JW, Birss AJ, Szmigielski B, Potempa J. 2007 Sequential action of R- and K-specific
gingipains of Porphyromonas gingivalis in the generation of the heam-containing pigment
from
oxyhaemoglobin.
Arch
Biochem
Biophys.
465(1):
44-49.
doi:
10.1016/j.abb.2007.05.011
Thornton B, Basu C. 2015. Rapid and simple method of qPCR primer design. Methods Mol Biol.
1275: 173-179. doi: 10.1007/978-1-4939-2365-6_13
Vanhatalo A, Blackwell JR, L’Heureux JE, Williams DW, Smith A, van der Giezen M, Winyard
PG, Kelly J, Jones AM. 2018. Nitrate-responsive oral microbiome modulates nitric oxide
homeostasis and blood pressure in humans. Free Radic Biol Med. 124(3): 21-30. doi:
10.1016/j.freeradbiomed.2018.05.078.
Wylie LJ, Kelly J, Bailey SJ, Blackwell JR, Skiba PF, Winyard PG, Jeukendrup AE, Vanhatalo A,
Jones AM. 2013. Beetroot juice and exercise: pharmacodynamic and dose-response
relationships. J Appl Physiol. 115(3): 325-336. doi: 10.1152/japplphysiol.00372.2013.

32

6

APPENDIX

Table 4. RNA concentrations of floss samples analyzed in this study (n=20).
Sample Name
RNA Concentration (ng/µL)
P01 Pre-F
tl
P02 Pre-F
5.15
P03 Pre-F
3.84
P04 Pre-F
3.29
P05 Pre-F
10.80
P06 Pre-F
3.58
P07 Pre-F
10.40
P08 Pre-F
tl
P09 Pre-F
7.36
P10 Pre-F
9.42
P01 Post-F
2.40
P02 Post-F
3.64
P03 Post-F
12.30
P04 Post-F
2.10
P05 Post-F
8.33
P06 Post-F
2.98
P07 Post-F
4.20
P08 Post-F
tl
P09 Post-F
16.20
P10 Post-F
23.50
P01-P10 denotes participant number; Pre-F denotes the floss samples taken pre-supplementation;
Post-F denotes the floss samples taken post-supplementation; tl = too low to quantify (<0.05
ng/µL)

33