Faculty of Science
DOES THE DRD4 “PERSONALITY GENE” DIFFER BETWEEN URBAN AND RURAL
MOUNTAIN CHICKADEES?
2024 | CLAIRE LOUISE HORSCH

B.Sc. HONOURS THESIS – BIOLOGY

DOES THE DRD4 “PERSONALITY GENE” DIFFER BETWEEN URBAN AND RURAL
MOUNTAIN CHICKADEES?
BY
CLAIRE LOUISE HORSCH

A THESIS SUBBITED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE
DEGREE OF
BACHELOR OF SCIENCE (HONS.)
in the
DEPAREMENT OF BIOLOGICAL SCIENCES
(Animal Biology)

This thesis has been accepted as conforming to the required standards by:
Matthew W. Reudink (Ph.D.) Co-supervisor, Dept. Biological Sciences
Eric Bottos (Ph.D.), Co-supervisor, Dept. Biological Sciences
Emily Studd (Ph.D.), External examiner, Dept. Biological Sciences

Dated this 28th day of August 2024, in Kamloops, British Columbia, Canada
© Claire Louise Horsch 2024

ABSTRACT
Urbanization is altering natural habitats worldwide, forcing species to adapt or acclimate to these
new environments to survive. One species that successfully resides in both rural and urban habitats
is the mountain chickadee (Poecile gambeli). In Kamloops, BC, populations of mountain
chickadees thrive in both habitats, with no observed difference in reproductive success. Previous
studies have investigated whether there are behavioural differences between urban and rural
mountain chickadees, finding evidence that anti-predator and neophobic behaviours (elements of
animal personality) differ between these populations. Personality is heritable, making it possible
to study whether the behavioural differences observed are a result of adaption or acclimation.
Polymorphisms in the dopamine receptor D4 gene (Drd4) have been associated with variation in
personality traits in great tits (Parus major), particularity with traits such as boldness and novelseeking behaviour. Specifically, a single nucleotide polymorphism (SNP) at the 830th nucleotide
of the Drd4 receptor gene (SNP830) has been associated with variation in personality, with bolder
individuals expressing C/T or T/T genotypes at SNP830. To explore whether the Drd4 gene might
be linked to behavioural differences in mountain chickadees and whether the frequency of the
Drd4 polymorphism differs between urban and rural birds, we analyzed 58 individuals from
Kamloops populations using sanger sequencing. We successfully validated methods for analyzing
the Drd4 gene and detecting Drd4 polymorphisms. All individuals tested were CC homozygous,
suggesting that the Drd4 SNP830 gene has little influence on behavioural variation seen in this
population. Future studies will investigate other genes that have been linked to personality
variation, such as the serotonin transporter gene (SERT), that might influence these behaviours.
Thesis Supervisors: Dr. Eric Bottos & Dr. Matthew W. Reudink

ii

ACKNOWLEDGEMENTS
I would like to thank E. Bottos, and M. Reudink, for their support and help throughout this thesis.
I acknowledge with deep respect and appreciation that this research was conducted on the
traditional, ancestral, and unceded territories of the Indigenous Peoples of British Columbia
including the Okanagan, Ktunaxa, Nlaka'pamux, Dakelh, Secwepemc, and many other nations.

iii

TABLE OF CONTENTS
ABSTRACT.................................................................................................................................... ii
ACKNOWLEDGEMENTS............................................................................................................iii
LIST OF FIGURES.........................................................................................................................v
LIST OF TABLES..........................................................................................................................vi
INTRODUCTION……………………….......................................................................................1
MATERIAL AND METHODS......................................................................................................6
RESULTS………………………………………………………………………………………..11
DISCUSSION……………………………………………………………………………………12
CONCLISION…………………………………………………………………………………...14
LITERATURE CITED…………………………………………………………………………..16

iv

LIST OF FIGURES
Figure 1. Rural (left) and urban (right) nestling sites……………………………………………..7
Figure 2. Sanger sequence electropherogram showing individual C/C homozygous…………...11
Figure 3. Agarose gel displaying the DNA amplified by the DRD4 Exon 1 primers (with annealing
temperature

of

62°C)

and

the

SNP830

primers

(with

annealing

temperature

of

62°C)……………………………………………………………………………………………..11
Figure 4. Resulting gel showing the different annealing temperature using our positive control
DNA……………………………………………………………………………………………...12

v

LIST OF TABLES
Table 1. Sex of urban and rural mountain chickadees examined……………………………….7
Table 2. Results of DRD4 polymorphisms……………………………………………………..12

vi

INTRODUCTION
Urbanization is rapidly increasing worldwide and to persist species must adapt or acclimate
to novel selective pressures present in the changing environment (Kozlovsky et al. 2017).
However, the ability of species to respond and cope with urbanization is highly variable, even
across closely related taxa. Species can generally be categorized based on their urban tolerance
group: urban avoiders, urban adapters, or urban exploiters (Humphrey 2023). Urban avoiders are
generally not found in urban environments because their survival needs (e.g., food, nest sites)
cannot be met in human-dominated landscapes (Humphrey 2023). Often, these are forestdependent species such as small insectivores, bears, wolves, and cougars. Species that can survive
and adapt in urban environments are referred to as urban adapters. Urban adapters utilize native
and non-native vegetation to persist and include species such as raccoons (Procyon lotor) and great
tits (Parus major) (Humphrey 2023). Lastly, species that thrive in urban habitats and exploit urban
resources, such as brown rats (Rattus norvegicus) and pigeons (Columba livia), are referred to as
urban exploiters (Humphrey 2023).
For urban adapter species that live and breed in urban environments, variation in individual
personality may play an important role in determining success in this environment (Oers 2004).
Personality refers to consistent heritable variation in an individual’s behaviour associated with
neophobia (fear of novel stimuli), exploratory, and cautious behaviour (Riyahi et al. 2017). For
example, the heritability of exploratory behaviour in great tits ranges from 0.22 to 0.41 (parentoffspring regressions) (Dingemanse 2002), indicating a strong genetic component underlying
variation in exploratory behaviour. Variation in personality can be especially important in
fluctuating environments (Fidler et al. 2007) because these traits can be closely linked to overall
fitness (Oers et al. 2004). Fluctuating environments exert diverse selective pressures on

1

individuals, thus maintaining variation as different personalities are favoured in different
conditions (Dingemanse 2004).
Though personality is complex and influenced by many different genes, variation in
exploratory behaviour has been directly linked to variation in the dopamine receptor (Drd4) gene
(Fidler et al. 2007; Timm et al. 2015; Korsten et al. 2010). The Drd4 receptor is responsible for
regulating the dopaminergic system, which plays an important role in motivation and reward
processing (Muda et al. 2018). Consequently, the Drd4 gene may influence behaviours and
personality, such as risk-taking (Muda et al. 2018). This is important because in a rural
environment, exhibiting cautious behaviour may be advantageous as it aids in avoiding risky
situations. However, in urban settings, excessive caution may impede exploration of potential new
habitats or food sources. Evidence indicates that the Drd4 gene influences behaviour across taxa,
including birds (Fidler et al. 2007; Timm et al. 2015; Korsten et al. 2010), humans (Kluger et al.
2002), dogs (Canis familiaris) (Ito et al. 2004) and horses (Equus caballus) (Momozawa et al.
2005).
In birds, great tits have received considerable attention with respect to the Drd4 gene.
Fidler et al. (2007) identified a single nucleotide polymorphism (SNP) at the 830th nucleotide of
the Drd4 receptor gene (SNP830) and determined that individuals can be CC homozygous, CT
heterozygous or TT homozygous at Drd4 SNP830. Fidler et al. (2007) found evidence that the
SNP830 region within the Drd4 gene is related to variation seen in bird’s exploratory behaviour.
Over four generations, Fidler et al. (2007) selected birds based on their slow and fast early
exploratory behaviour (EEB). EEB was used as a measure of novelty seeking behaviour, where
individuals were rated on a scale of 0-10 based on the time taken to visit four different trees.
Additionally, the researchers assessed the birds’ responses to a novel object placed on a perch,

2

rating the bird on a scale from 0 (did not touch the perch) to 5 (pecked the novel object). After
four generations, the authors examined differences in allele frequencies between the fast and slow
EEB groups, finding that birds with fast EEB scores displayed the T allele at a higher frequency
when compared to birds with slow EEB. Specifically, homozygous CC individuals appeared at a
frequency of 0.3 in the fast EEB group and 0.9 in slow EEB group. Heterozygous CT individuals
were more common in the fast group, with a frequency of 0.7 compared to 0.1 in the slow EEB
group. Homozygous TT individual appeared at a frequency of 0.1 in the fast EEB and were absent
in the slow EEB group. Further supporting these findings, Timm et al. (2018) also provided
evidence linking the SNP830 variant in the Drd4 gene to exploratory behaviour in great tits.
However, Timm et al. (2018) found that heterozygous CT individuals displayed greater
exploratory behaviour, demonstrated by approaching the novel object more frequently when
compared to CC homozygous and TT homozygous individuals.
Because urban environments are highly variable with frequent novel stimuli, Riyahi et al.
(2017) hypothesized that bolder birds (and those with T alleles) should be more frequently found
in urban environments. Indeed, when comparing urban and rural great tits, Riyahi et al. (2017)
found that urban great tits displayed greater exploratory behaviours and boldness compared to rural
birds. In addition, Riyahi et al. (2017) determined that the allele frequency of the Drd4 SNP830
polymorphism differed significantly between the rural and urban populations (Riyahi et al. 2017).
In contrast to Fidler et al. (2007), however, Riyahi et al. 2017 found that urban birds displayed the
T allele at a lower frequency compared to the rural birds, suggesting that the role of Drd4 SNP830
polymorphisms may be population- and context-specific.
Though links between personality and Drd4 polymorphisms in European tit species have
been demonstrated, whether Drd4 polymorphisms are associated with personality in con-familial

3

North American chickadee species remains unresolved. A previous study examining boldness in
Black-capped Chickadees (Poecile atricapillus), Carolina Chickadees (P. carolinensis), and their
hybrids found that boldness was not associated with variation in the Drd4 genotype (Heuermann
2020). Therefore, it remains unclear if the Drd4 gene is associated with behaviour in North
American chickadees. Mountain chickadees (Poecile gambeli) thrive in both urban and rural
environments with no apparent difference in reproductive success between these two populations
(Marini 2017). It is currently unclear if mountain chickadees are successful in urban habitats
because of behavioural flexibility and an ability to quickly acclimate to novel environments or if
urban populations are adapting to this new environment—a situation which would result in a
change in allele frequencies between the urban and rural populations. In addition, differences in
allele frequencies (e.g., in the frequency of C and T alleles) could also arise if bolder chickadees
differentially settle in urban environments.
Smith et al. (2021) conducted a study comparing anti-predator behavioural responses to the
presentation of a snake predator model atop nests in both urban and rural environments. Rural
mountain chickadees exhibited a stronger anti-predator response than urban chickadees (Smith et
al. 2021). However, because snakes are an uncommon nest predator in the region, the authors
suggested that this differential response could be due to either low exposure to snakes in urban
environments or the birds in both habitats simply perceiving the snake model as a novel object
rather than a predator and the differential response resulting from differences in neophobia across
habitats.
To test this idea, a follow up study by Heales et al. (2024) examined rural and urban
mountain chickadees responses to both a simulated predator (squirrel model) and a novel stimulus
(red plastic cup). As expected, mountain chickadees had a greater response to the predator model

4

than the novel stimulus. However, when presented with the novel stimulus, rural birds displayed
more neophobic behaviour and spent less time in the nest. In contrast, the urban bird quickly reentered the nest, and spent little time examining the novel stimulus. Urban birds presented with a
predator model displayed a greater response compared to their response to the novel stimulus than
the rural birds (Heales et al. 2024). These results suggest a difference in neophobic behaviour
between urban and rural individuals, though it remains unclear if urban birds display less
neophobic responses because of acclimation (frequent exposure to novel, man-made objects) or if
urban birds are genetically distinct from rural birds, potentially with respect to variation in the
Drd4 SNP830 polymorphism.
Another potential gene that may influence behaviour is the serotonin transporter (SERT)
gene. Grunst et al. (2021) found evidence that the SERT gene is associated with neophobia and
exploratory behaviour. Furthermore, Timm et al. (2018) determined that SERT gene exon 3 and
exon 8 were linked to risk taking behaviour in great tits.
If Drd4 SNP830 polymorphisms are associated with personality differences between the
rural and urban mountain chickadees populations, then allele frequencies of the Drd4 gene may
vary between these populations. In this study we examined the allele frequency of the Drd4 gene
SNP830 polymorphism in urban and rural mountain chickadee populations. Using 3 years of data
from 30 chickadees from urban environments and 28 chickadees from rural environments, we
tested whether Drd4 SNP830 polymorphisms varied by habitat type. In addition, we explored the
potential for future research on the SERT gene by trying to amplify the SERT gene. This study
aims to provide insight into whether the mountain chickadee’s ability to thrive in urban habitats is
a result of acclimation or if we can detect differences in genotypes between these habitats.

5

MATERIALS AND METHODS
Birds Studied
Adult mountain chickadee feathers were collected from 46 nesting boxes in both urban and
rural locations across Kamloops, BC, Canada during the 2014 to 2016 breeding seasons. To obtain
DNA samples, adult birds were captured at the nest while feeding nestlings and two tail feathers
were collected (see Bonderud et al. 2017 for more detail). Capture and sample collection was done
under a TRU Animal Care permit and CWS Master Bander permit 10834. We examined 58
mountain chickadee DNA samples consisting of both male and female (see table 1). Rural
mountain chickadee feathers were collected from Kenna Cartwright Park which is an 8 km2 area
consisting mainly of a Great Basin grassland habitat and some forests (Bonderud et al. 2017). Rural
mountain chickadee nesting boxes were erected in the forest, which contains mature ponderosa
pine (Pinus ponderosa), and Douglas fir (Pseudotsuga mensiesii) (Bonderud et al. 2017). Urban
mountain chickadee feathers were collected from nesting boxes located throughout 37 km2 of
urban and suburban habitats in Kamloops (including Thompson Rivers University, urban parks,
and backyards of participating residents). The urban habitat mainly consisted of immature Douglas
fir trees and various species of native and non-native deciduous trees and shrubs (Bonderud et al.
2017).

6

Figure 1. Rural (left) and urban (right) nestling sites.
Table 1. Sex of urban and rural mountain chickadees examined.
Male
9
8

Rural
Urban

Female
15
18

Unknown
4
4

PCR Optimization
To determine the primers and optimal PCR conditions for examining the Drd4 gene
polymorphisms in mountain chickadees, we extracted DNA from a tissue sample from a deceased
nestling. Using a Qubit dsDNA HS Assay Kit and a Qubit fluorometer (Themo Fisher Scientific),
we determined that our nestling sample contained 27.7 µg/mL of DNA. We used this DNA as a
positive control to test different primers and find the optimal PCR condition for developing genetic
assays for mountain chickadees.
We tested the SNP830 forward primer (5′ AAGCTGAGAGGCTGCATCTATGG 3′) and
the reverse primer SNP830 (5′ATCCCACTGTTCATCCCACACTC 3′). The PCR reactions
consisted of 5 µM of SNP830F, 5 µM of SNP830R, 12.5 µL of 2x GoTaq G2 Green Master Mix
(Fisher Scientific), 7.5 µL of sterile PCR water, and 2.5 µL of genomic DNA which created 25 µL
reactions. We amplified the genomic DNA using the following reaction conditions: initial

7

denaturation at 94°C for 4 min, 27 cycles of 94°C for 30 s, 61°C for 30 s, and 72°C for 30 s, and
a final extension of 72.0°C for 1 min. The SNP830 primers and the reaction conditions were chosen
based on a previous study examining the DRD4 gene in great tits (Fidler et al. 2007).
Furthermore, we tested a PCR assay targeting the serotonin transporter (SERT) gene using SERT F
(5′CATCTTCTCCTTTGCTACAGCC3′) and the SERT R (5′ACAGAGCCTCAGAAGTTAGTTGA3′)
primers. We also ran PCR reactions using Drd4 exon 1F (5′ CGGAGTAGACGTAGAGGGGCAGGAC
3′) and DRD4 exon 1R (5′ GCTCCTCCCGCGGCTCGGCGGGCA 3′) primers. Both PCR reactions
were run under the following reaction conditions: initial denaturation at 94°C for 5 min, 94°C for
30 s, 35 cycles of 62°C for 30 s, 72°C for 1 min, and a final extension of 72.0°C for 5 min.
We further tested the SNP830F and SNP830R primers under different reaction conditions:
initial denaturation at 94°C for 4 min, one cycle of 94°C for 30 s, 35 cycles of 55°C for 30 s, and
72°C for 30 s, and a final extension of 72.0°C for 1 min.
Finally, we tested several different annealing temperatures for the SNP830 primers to
determine if higher temperatures would successfully amplify the Drd4 target, to evaluate whether
we could optimize PCR conditions to be compatible with downstream sequencing steps (BigDye ®
Direct cycle Sequencing Kit protocols). The reaction conditions were 95°C for 5 min, 95°C for
30s o, 35 cycles of annealing at 50°C, 53°C, 55°C, 58°C, 61°C, or 63°C /30 s, 72°C for 1 min, and
final extension of 72.0°C for 5 min.
The products of all PCR reactions were run on a 2% agarose gel (consisting of 50 mL of
TAE buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA, pH 8.0), 1g agarose, 2 µL of Red Safe
nucleic acid stain, and 5 µL of the PCR product) for 40 min at 80V.

8

Sample Processing and Sequencing
After determining the range of annealing temperatures that successfully amplify the
mountain chickadee DNA, we were able to apply a Sanger sequencing assay targeting Drd4
SNP830 to examine 58 mountain chickadee DNA samples. We extracted genomic DNA from
feather samples using the standard protocol for the QIAamp DNA Mini Kit. We also used
previously extracted DNA from Bonderud et al (2017), who extracted feather DNA using QIAamp
DNA Micro Kit.
We examined the polymorphism located at SNP830 Drd4 gene in mountain chickadees
using BigDye® Direct cycle Sequencing Kit. Drd4 primers were modified to contain an additional
M13 priming site sequence to make the assay compatible with the BigDye® Direct cycle
Sequencing Kit; therefore, the DNA was amplified from genomic DNA using M13_SNP830
forward primer (0.8 µM): 5′ TGTAAAACGACGGCCAGTAAGCTGAGAGGCTGCATCTATGG 3′
and the M13_SNP830 reverse primer (0.8 µM):
5′ CAGGAAACAGCTATGACCATCCCACTGTTCATCCCACACTC 3′. The PCR reactions
consisted of 0.8 µM of M13_SNP830F, 0.8 µM of m13_SNP830R, 5.0 µL of BigDye® Direct
PCR Master Mix, 2.5 µL of sterile PCR water, and 1.0 µL of genomic DNA for a total volume of
10.0µL and were run under the reaction conditions: 95°C/10 min, one cycle; 96°C/3 s, 62°C/15 s,
68°C/30 s, 35 cycles; 72.0°C/2 min, hold; 4.0°C/∞, hold. Cycle sequencing was performed on the
amplified DNA following BigDye® Direct cycle Sequencing Kit protocol. Big Dye® Direct M13
Forward Primer (1.0µL) and Big Dye® Direct Sequencing Master Mix (2.0µL) was added to the
10 µL amplified DNA and the following thermocycler conditions: 37°C/15 min, hold; 80.0°C/2
min, hold; 96.0°C/1 min, hold; 96.0°C/10 sec, 50°C/5 sec, 60°C/75 sec, 25 cycles. The sequencing
reactions were then purified using ethanol/EDTA precipitation. The plate containing the

9

sequencing reactions was centrifuged in a swinging bucket centrifuge for 10 seconds at 1,000 x g.
The adhesive Film from the plate was removed, and 10µL of the sequencing reaction was
transferred into new plate. To each reaction, 2.5µL of 125mM EDTA solution and 30µL of
absolute ethanol was added for a total volume of 42.5µL/well. The plate was resealed, vortexed
for 10 seconds, and then centrifuged for 10 seconds at 1,000 x g. It was then incubated at room
temperature for 15 minutes and centrifuged at 1,870 x g (4°C) for 45 minutes. The adhesive film
was removed, and absorbent paper was placed into the centrifuge. The plate was carefully inverted
onto the absorbent paper and centrifuged at 185 x g for 1 minute. The plate was then left to dry at
room temperature for 10 minutes while protected from light. The samples were then analyzed in
using a SeqStudio Genetic Analyzer (ThermoFisher Scientific).

Analyses
We analyzed the sequencing electropherograms in Sequencing Analysis Software v7
(ThermoFisher Scientific). We confirmed the quality of the electropherograms visually in the
region of interest and located the polymorphism using the leading sequence, which was determined
using NCBI gene sequence of the great tit (Parus major): we recorded whether the individual was CC
homozygous, CT heterozygous or TT homozygous. Using the leading sequence, ′GCCCCTATGCCCGT′,
we were able to locate the polymorphism which occurred at roughly 117 base pair (bp). Directly following
the leading sequence, the sequence ′GCCGGC′ or ′GCTGGC′ appeared. If the individual was CC
homozygous the sequence following the leading sequence was ′GCCGGC′. If the individual was
TT homozygous the sequence following the leading sequence was GCTGGC. If the individual was
heterozygous, it would have both a C and T present.

10

Figure 2. Sanger sequence electropherogram showing individual C/C homozygous.
RESULTS
The SNP830 primers successfully amplified the DNA which allowed us to determine the
optimal PCR temperatures. However, the Drd4 exon 1 primers (figure 3) and the SERT primers
did not amplify the targeted DNA.

Figure 3. Agarose gel displaying the DNA amplified by the Drd4 Exon 1 primers (with annealing
temperature of 62°C) and the SNP830 primers (with annealing temperature of 62°C).

11

The SNP830 primer amplified DNA at annealing temperatures 50°C, 53°C, 55°C, 58°C, 61°C (see
figure 4).

Figure 4. Resulting gel showing the different annealing temperature using our positive control
DNA, which revealed that optimal annealing temperate is 55°C.
All individuals tested were CC homozygous for Drd4 polymorphism (Table 1). Therefore, there

was no difference in allele frequence between the two populations examined.
Table 2. Frequency of each Drd4 polymorphisms in both rural and urban mountain chickadees.
DRD4
C/C
C/T
T/T
Polymorphism
Rural
28
0
0
Urban
30
0
0

DISCUSSION
This study examined variation in the Drd4 gene, which is associated with personality
variation, to explore whether differences in behaviour observed between urban and rural Kamloops
mountain chickadees are a result of acclimation or genetic differences between populations. In
order to analyze polymorphisms in the Drd4 gene, we evaluated several primer pairs previously
used for genotyping great tits to examine the same genes in mountain chickadees. Though several
primer pairs did not amplify DNA from our mountain chickadee samples, we successfully

12

validated a method for analyzing the Drd4 SNP830 sequence in mountain chickadees—a region
that has shown strong associations with personality in European great tits. Using this method, we
successfully examined Drd4 SNP830 alleles in 58 mountain chickadees from urban and rural
populations; however, we did not detect any genetic variation in the Drd4 SNP830 in the sampled
population: all individuals tested in both populations were homozygous for the CC allele.
Given the lack of variation we detected in our population, it is unlikely that variation in the
Drd4 SNP830 polymorphism has an important influence on behaviour in our population of
mountain chickadees. Our results suggest that differences in behaviour responses in the rural and
urban population observed by Smith et al. (2018) and Heales et al. (2024) were not influenced by
the Drd4 SNP830 gene. Even though we did not find evidence that suggests the Drd4 gene is
responsible for the behavioural differences seen in the Kamloops mountain chickadee populations,
behavioural traits are likely influenced by a combination of many genes and environmental factors
(Grunst et al. 2021). As such, further research should be conducted that investigates other potential
genes that are associated with personality variation such as the serotonin transporter gene (SERT).
The SERT gene has been associated with personality variation in the great tits, influencing
neophobia, and exploratory behaviour (Grunst et al. 2021). Specifically, Riyahi et al. (2015)
investigated the SERT SNP234 polymorphism and found a significant correlation with novelty
seeking behaviour in great tits. Their study revealed that individuals homozygous for the T allele
at SERT SNP234 were quicker to approach novel objects compared to those who were TA
heterozygous. Furthermore, Riyahi et al. (2015) observed a higher frequency of TT homozygous
individuals in urban environments.
Initial attempts to amplify the Drd4 gene using the Drd4 exon 1 primers and the SERT
gene using the SERT primers were unsuccessful. Further testing of these primers at different

13

annealing temperature is needed to confirm that these primers fail to amplify mountain chickadee
DNA. Because these primers were designed for great tits, it is possible that these primer sets failed
because they were not specific enough for the DNA template or were unable to amplify the target
DNA (Biocompare 2013). In future studies, designing primers specific to mountain chickadee
DNA could potentially improve amplification success (Biocompare 2013).
Though many genes are associated with variation in personality and behaviour, our results
are consistent with behavioural plasticity, rather than genetic differentiation, in driving differences
in behaviour between urban and rural mountain chickadees, as we found no genetic difference of
the Drd4 gene between the rural and urban populations. Previous research has suggested that the
mountain chickadees ability to reside in harsh, higher elevation climates is associated with
enhanced problem-solving abilities compared to those found in at low elevation, which may be
attributed to behaviour plasticly (Kozlovsky et al. 2015). Therefore, it is possible that mountain
chickadees are able to survive and utilize urban habitats due to their behavioural plasticity.
CONCLUSION
In this study, we successfully amplified the Drd4 gene in mountain chickadees.
Surprisingly, however, we found no evidence of a polymorphism at this gene, with all individuals
being C/C homozygous at SNP830. Future studies should investigate other potential genes that
could influence personality and behaviour such as the SERT gene. If it is determined that SERT
polymorphisms are present in the Kamloops mountain chickadee population, then we can use data
that has been previously collected on mountain chickadees behavioural response to predator
models and novel stimuli to determine if exploratory, boldness and novelty seeking behaviour is
correlated with the polymorphism of the SERT gene in these populations. However, because we
found no difference in allele frequency of the Drd4 gene, our data our consistent with the idea that

14

variation in behaviour between urban and rural chickadees may arise through behavioural
flexibility and acclimation to novel, anthropogenic environments.

15

LITERATURE CITED
Branch CL, Pravosudov VV. Mountain chickadees from different elevations sing different songs:
acoustic adaptation, temporal drift or signal of local adaptation? R. Soc. Open sci. 2015
2: 150019. http://dx.doi.org/10.1098/rsos.150019
Dingemanse NJ, Both C, Drent PJ, Oers KV, Noordwijk AJV. Repeatability and heritability of
exploratory behaviour in great tits from the wild. Anim. Behav. 2002. 64(6), 929-938.
https://doi.org/10.1006/anbe.2002.2006
Dingemanse NJ, Both C, Drent PJ, Tinbergen JM. Fitness consequences of avian personalities in
a fluctuating environment. Proc Biol Sci. 2004. 271(1541), 847–852.
https://doi.org/10.1098/rspb.2004.2680
Fidler AE, Van Oers K, Drent PJ, Kuhn S, Mueller JC, Kempenaers B. Drd4 gene
polymorphisms are associated with personality variation in a passerine bird. Proc. R. Soc.
B. 2007. 274(1619):1685–1691. doi:10.1098/rspb.2007.0337
Heales HE, Reudink MW, Flood NJ, Studd E. Personality and predation risk in urban-nesting
mountain chickadees. 2023. Thompson River University.
Heuermann TM. Boldness in Black-Capped Chickadees (Pocile Atricapillus), Carolina
Chickadees (P. Carolinensis), and Their Hybrids: Behavioral Variation and Genetic
Correlates. ProQuest Dissertations & Theses Global. 2020.
https://www.proquest.com/dissertations-theses/boldness-black-capped-chickadees-empoecile/docview/2486469344/se-2
Humphrey JE, Haslem A, Bennett AF. Avoid, adapt or exploit: Re-visiting bird responses to
urbanization using a novel landscape approach. 2023. 48.
https://doi.org/10.1016/j.gecco.2023.e02735

16

Ito H. Nara H, Inoue-Murayama M, Shimada MK, Koshimura A, Ueda Y, Kitagawa
H, Takeuchi Y, Mori Y, Murayama Y, et al. Allele frequency distribution of the canine
dopamine receptor D4 gene exon III and I in 23 breeds. J. Vet. Med. Sci. 2004. 66, 815–
820. doi:10.1292/jvms.66.815
Kluger AN, Siegfried Z, Ebstein RP. A metaanalysis of the association between DRD4
polymorphism and novelty seeking. Mol. Psych. 2002. 7, 712–717. (doi:10.
1038/sj.mp.4001082)
Korsten P, Mueller JC, Hermannstädter C, Bouwman KM, Dingemanse NJ, Drent PJ, Liedvogel
M, Matthysen E, van Oers K, van Overveld T, Patrick SC, Quinn JL, Sheldon BC,
Tinbergen JM, Kempenaers B. Association between DRD4 gene polymorphism and
personality variation in great tits: a test across four wild populations. Mol Ecol. 2010.
(4):832-43. doi: 10.1111/j.1365-294X.2009. 04518.x
Kozlovsky DY, Branch CL, Pravosudov VV. Problem-solving ability and response to novelty in
mountain chickadees (Poecile gambeli) from different elevations. Behav Ecol Sociobiol.
2015. 69(4): 635-643. Doi: 10.1007?s00265-015-1874-4
Kozlovsky DY, Weissgerber, EA, Pravosudov, VV. What makes specialized food-caching
mountain chickadees successful city slickers? Proc. R. Soc. B. 2017. 284(1855). doi:
https://doi.org/10.1098/rspb.2016.2613
Kubikova L, & Kostál, L. Dopaminergic system in birdsong learning and maintenance. J chem
neuroanat. 2010. 39(2): 112–123. https://doi.org/10.1016/j.jchemneu.2009.10.004
Marini LD, Otter KA, LaZerte E, Reudink MW. Urban environments are associated with earlier
clutches and faster nestling feather growth compared to natural habitats. Urban Ecosyst.
2017. 20: 1291-1300. https://doi.org/10.1007/s11252-017-0681-2

17

Momozawa Y, Takeuchi Y, Kusunose R, Kikusui T, Mori Y. Association between equine
temperament and polymorphisms in dopamine D4 receptor gene. Mamm. Genome. 2005.
16, 538–544. doi:10.1007/s00335-005- 0021-3
Muda R, Kicia M, Michalak-Wojnowska M, Ginszt M, Filip A, Gawda P, Majcher P. The
Dopamine Receptor D4 Gene (DRD4) and Financial Risk-Taking: Stimulating and
Instrumental Risk-Taking Propensity and Motivation to Engage in Investment Activity.
Front Behav Neurosci. 2018 Mar 2;12:34. doi: 10.3389/fnbeh.2018.00034. PMID:
29551965; PMCID: PMC5840237.
Primers, by Design – Tips for Optimal DNA Primer Design. 2013. Biocompare.
https://www.biocompare.com/Bench-Tips/133581-Primers-by-Design-Tips-for-OptimalDNA-PrimerDesign/#:~:text=If%20multiple%20PCR%20optimizations%20have,is%20to%20design
%20new%20primers.
Riyahi S, Björklund M, Mateos-Gonzalez F, Senar JC. Personality and urbanization: behavioural
traits and DRD4 SNP830 polymorphisms in great tits in Barcelona city. J Ethol. 2017. 35:
101-108. doi: https://doi.org/10.1007/s10164-016-0496-2
Riyahi S, Sánchez-Delgado M, Calafell F, Monk D, Senar JC. Combined epigenetic and
intraspecific variation of the DRD4 and SERT genes influence novelty seeking behavior
in great tit Parus major. Epigenetics. 2015.10(6) 516525, doi: 10.1080/15592294.2015.1046027

Smith BL, Snell CL, Reudink MW, Otter KA. Urban-nesting mountain chickadees have a
reduced response to a simulated predator. Behaviour. 2021. 159(2022): 301-320.
doi:10.1163/1568539X-bja10122

18

Timm K, Mägi M, Telve K, Tilgar V. The behavioural response of Great Tits to novel
environment and handling is affected by the DRD4 gene. Ibis. 2018. 161(1): 91- 100.
doi: https://doi-org.ezproxy.tru.ca/10.1111/ibi.12604
Timm K, Tilgar V, Saag P. DRD4 gene polymorphism in great tits: gender-specific association
with behavioural variation in the wild. Behav Ecol Sociobiol. 2015. 69: 729-735.
doi:10.1007/s00265-015-1887-z
Tryjanowski P, Møller AP, Morelli F, Biaduń W, Brauze T, Ciach M, Czechowski P, Czyż S,
Dulisz B, Goławski A, Hetmański T, Indykiewicz P, Mitrus C,14 Myczko Ł, Nowakowski
JJ, Polakowski M, Takacs V, Wysocki D, Zduniak P. Urbanization affects neophilia and
risk-taking at bird-feeders. Sci Rep. 2016. 6(28575). doi:
https://doi.org/10.1038/srep28575
van Oers K, Drent P, de Jong G, van Noordwijk A. Additive and nonadditive genetic variation in
avian personality traits. Heredity. 2004. 93: 496–503.
https://doi.org/10.1038/sj.hdy.6800530

19